Please wait...

Biology Test 72
Menu grid icon
Result Result point icon
Biology Test 72
  • Goals icon

    /

    Score
  • Trophy icon

    -

    Rank
White alarm icon Time Taken: -
Result frame illustration
  • Question 1/10
    4 / -1

    Which of the following is the correct statement?

  • Question 2/10
    4 / -1

    How many amino acid can be polymerised by given m-RNA sequence during translation in a bacteria ?

    5' AUGUCCACGAUAGACUGAUAA3'

  • Question 3/10
    4 / -1

    The thylakoid membrane bears several F0 – F1 particle ATPase/ATP synthase. Which of following is incorrect for these particles?

  • Question 4/10
    4 / -1

    Super bug is :

  • Question 5/10
    4 / -1

    A DNA finger printing process involves :-

  • Question 6/10
    4 / -1

     

    Forelimbs of frog have :

  • Question 7/10
    4 / -1

    Directions For Questions

    Read the following steps of inspiration.

    A. Increases thoracic volume

    B. Air moves into lungs

    C. Contraction in diaphragm and EICM

    D. Increases pulmonary volume

    E. Lungs expand

    F. Decreases the intra pulmonary pressure (IPP)

    ...view full instructions

     

    Find out the correct sequence of these steps :-

  • Question 8/10
    4 / -1

    Modern biotechnology consist :-

  • Question 9/10
    4 / -1

    Which of the following is not a alien species in India?

  • Question 10/10
    4 / -1

    Ecology explains us :-

Close button icon
User Profile
-

Correct (-)

Wrong (-)

Skipped (-)

  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • 7
  • 8
  • 9
  • 10
Mockers logo Get latest Exam Updates
& Study Material Alerts!
No, Thanks
Arrow pointer icon
Click on Allow to receive notifications
Notification bell icon ×
Open Now